• Users Online: 505
  • Print this page
  • Email this page

 Table of Contents  
ORIGINAL ARTICLE
Year : 2017  |  Volume : 1  |  Issue : 1  |  Page : 9-12

Analysis of the Fragile X Mental Retardation 1 Premutation in Han Chinese Women Presenting with Primary Ovarian Insufficiency


1 Obstetrics and Gynecology Hospital, State Key Laboratory of Genetic Engineering at School of Life Sciences, Institute of Reproduction and Development, Fudan University, Shanghai 200011; Key Laboratory of Reproduction Regulation of NPFPC, Collaborative Innovation Center of Genetics and Development, Fudan University, Shanghai 200032, China
2 Obstetrics and Gynecology Hospital, State Key Laboratory of Genetic Engineering at School of Life Sciences, Institute of Reproduction and Development, Fudan University, Shanghai 200011; Key Laboratory of Reproduction Regulation of NPFPC, Collaborative Innovation Center of Genetics and Development, Fudan University, Shanghai 200032; Shanghai Key Laboratory of Female Reproductive Endocrine Related Diseases, Shanghai 200011, China
3 Obstetrics and Gynecology Hospital, State Key Laboratory of Genetic Engineering at School of Life Sciences, Institute of Reproduction and Development, Fudan University, Shanghai 200011, China
4 Obstetrics and Gynecology Hospital, State Key Laboratory of Genetic Engineering at School of Life Sciences, Institute of Reproduction and Development, Fudan University, Shanghai 200011; Shanghai Key Laboratory of Female Reproductive Endocrine Related Diseases, Shanghai 200011, China

Date of Web Publication17-Jul-2017

Correspondence Address:
Qi-Qi Wang
Obstetrics and Gynecology Hospital, Fudan University, Shanghai 200011
China
Xiao-Jin Zhang
Obstetrics and Gynecology Hospital, Fudan University, Shanghai 200011
China
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/2096-2924.210692

Rights and Permissions
  Abstract 

Background: The aim of this study is to investigate the prevalence of the fragile X mental retardation 1 (FMR1) gene premutation in Han Chinese women with primary ovarian insufficiency (POI) using a rapid and cost-effective method.
Methods: A total of 153 Han Chinese women with sporadic POI were systematically analyzed for trinucleotide repeats within the FMR1 gene. We employed an improved strategy to screen for cytosine-guanine-guanine repeats in the 5' untranslated region of the FMR1 gene. Before using the previously reported FragilEase polymerase chain reaction (PCR) method for premutation identification, we developed a new cost-effective PCR-based method to exclude most of the normal allele carriers during the initial screening stage.
Results: In our initial screening, 62.1% of women with POI were found to carry heterozygous normal alleles of FMR1, which were recognized by our sensitive and cost-effective method. The remaining women were further screened for the presence of the FMR1 premutation. We identified a Han Chinese woman with a premutation allele of FMR1 out of 153 sporadic POI women (0.7%).
Conclusions: The frequent FMR1 premutation in Caucasian individuals with POI may not be a common genetic cause of sporadic POI in the Han Chinese population.

Keywords: Cytosine-guanine-guanine Repeats; Fragile X Mental Retardation 1 Premutation; Polymerase Chain Reaction; Primary Ovarian Insufficiency


How to cite this article:
Chen Q, Wang QQ, Cai BZ, Ren XJ, Zhang F, Zhang XJ. Analysis of the Fragile X Mental Retardation 1 Premutation in Han Chinese Women Presenting with Primary Ovarian Insufficiency. Reprod Dev Med 2017;1:9-12

How to cite this URL:
Chen Q, Wang QQ, Cai BZ, Ren XJ, Zhang F, Zhang XJ. Analysis of the Fragile X Mental Retardation 1 Premutation in Han Chinese Women Presenting with Primary Ovarian Insufficiency. Reprod Dev Med [serial online] 2017 [cited 2020 May 29];1:9-12. Available from: http://www.repdevmed.org/text.asp?2017/1/1/9/210692




  Introduction Top


Primary ovarian insufficiency (POI), formerly referred to as premature ovarian failure (POF), occurs in approximately 1%–2% of women before the age of 40 and 0.1% of women before the age of 30.[1] The clinical diagnosis is based on the presence of amenorrhea for >4 months in a woman younger than 40 with increased gonadotropin levels, in particular follicle-stimulating hormone (FSH), and a decreased estradiol level.[2] POI is a highly heterogeneous disorder. Its known causes include genetic, autoimmune, and metabolic defects, as well as infectious and iatrogenic factors.[3] However, these causes account for only 10% of POI cases. The remaining 90% of POI cases are idiopathic, and their pathogenic mechanisms are largely unknown.[4],[5]

The fragile X mental retardation 1 (FMR1) gene is one of the most prominent genes associated with POI. The FMR1 gene is located on the human X-chromosome (Xq27.3), and it contains an unstable cytosine-guanine-guanine (CGG) repeat in the 5' untranslated region.[6] Repeats' sizes fall into four categories, namely, unaffected (45 bp), intermediate (45 bp-54 bp), premutation (55 bp-200 bp), and full mutation (200 bp).[7] In 1991, Cronister et al.[8] reported that 13% of normal-IQ heterozygote fragile X females had experienced premature menopause. Allingham-Hawkins et al.[9] observed premutation alleles in 16% of women with POI in various human populations. In a recent study of Iranian women, 12% of women with POF were found to have FMR1 premutation alleles.[10] However, the prevalence of the FMR1 premutation varies widely across human populations from different geographical regions.[3] In a northern Chinese population, only two FMR1 premutation carriers were reported in 379 individuals with POF, suggesting that the potential contribution of the FMR1 premutation to POI in Chinese women is much lower than that in Caucasian women (3.3%-6.7%).[11] Thus, the prevalence of the FMR1 premutation in the Chinese Han population needs to be reevaluated.

Different methods have been employed to investigate the FMR1 repeat region. For example, polymerase chain reaction (PCR) assays, agarose gel electrophoresis, capillary electrophoresis, and Southern blot analysis are often used to identify CGG repeats. Furthermore, there are several commercial FMR1 kits. However, they are expensive and not cost-effective for screening a large number of samples. Here, we developed a sensitive method to identify most normal alleles during initial screening, which can help reduce costs for the identification of CGG repeats within the FMR1 gene.


  Methods Top


Patients

We enrolled 153 Han Chinese women with clinically confirmed POI between September 2014 and June 2016 at the Obstetrics and Gynecology Hospital, Fudan University (Shanghai, China). All cases had the sporadic form of POI, and most participants resided in East China. Women with abnormal karyotypes or iatrogenic causes were excluded from this study. This study was approved by the Institutional Review Board of the School of Life Sciences, Fudan University.

Initial screening of normal CGG repeat alleles

Genomic DNA was extracted from whole blood with the Puregene Blood Core Kit B (QIAGEN). The PCR assay was modified from previously published protocols with fluorescently labeled primers (forward: GCTCAGCTCCGTTTCGGTTTCACTTCCGGT; reverse: FAM-AGCCCCGCACTTCCACCACCAGCTCCTCCA).[12] The PCR mix contained 2.5 μL of 10× PCR buffer, 2 μL of 2.5 mM dNTPs, 8 μL of Q solution, 0.75 pmol of each primer, and 1 unit of HotStar Taq DNA Polymerase (QIAGEN). Approximately 50 ng of genomic DNA was added for a final PCR volume of 25 μL. The cycling program was started with an initial denaturation at 98°C for 5 min, followed by 10 cycles at 97°C for 30 s, 64°C for 2 min, and 68°C for 8 min, and then 25 cycles at 97°C for 35 s, 64°C for 2 min, and 68°C for 8 min and 20 s. The sample was then maintained at 4°C overnight.[13] Amplicons were separated by electrophoresis on a 5% agarose gel run at 130 V for 90 min. Allele sizes were also determined by capillary electrophoresis with a GeneScan 500 LIZ size standard for sizing on an ABI 3730 Genetic Analyzer (Applied Biosystems). Data were analyzed using GeneMapper 4.0 software (Applied Biosystems, Thermo Fisher Scientific Corp., Waltham, MA, USA).

Premutation analysis by FragilEase PCR

Upon identification of a single allele in a woman with POI, the fragile X-related-specific PCR assay was performed using the FragilEase PCR Reagent Kit (PerkinElmer).[14] After amplification, the PCR products were resolved on the LabChip MultiDX Microfluidics Instrument. FRAXSOFT analysis software (PerkinElmer, Turku, Finland) was used to measure the number of CGG repeats in the tested samples.


  Results Top


A sentitive and cost-effective method for the initial screening of CGG repeats

In this study, we developed a simple and rapid PCR-based method for the initial screening of normal alleles of FMR1 CGG repeats. All samples were amplified successfully. A total of 95 out of 153 (62.1%) Han Chinese women with POI carried normal alleles, which were shorter than those of healthy women, with 44 and 49 CGG repeats on the 5% agarose gel, respectively. These observed repeat numbers were subsequently confirmed by capillary electrophoresis [Figure 1]. Notably, subject P033 carried two normal alleles with only one CGG repeat difference (i.e., 3 bp difference in the size of the PCR product), which was distinguished by our sensitive analysis [Figure 1]. Furthermore, the repeat numbers generated by our assay were generally consistent with those obtained from the FragilEase PCR kit [Figure 1].
Figure 1: (a) Electrophoresis of the PCR products on a 5% agarose gel. Lane 6 (44 CGG repeats) and lane 8 (49 CGG repeats) serve as the controls. Lanes 2, 3, and 4 show two normal alleles. Lanes 1, 5, and 7 show single alleles that can be alternatively explained by homozygotes or one normal allele plus an unamplified premutation allele. (b) Capillary electrophoresis of subject P033 [lane 2 in Figure 1a] shows two normal alleles with only one CGG repeat difference. (c) The previously reported method using FRAXSOFT analysis software incorrectly shows a homozygote in subject P033.

Click here to view


Prevalence of the FMR1 premutation in Han Chinese women with POI

The remaining 58 women showed only one allele in our initial screening. These women might carry the homozygous allele of FMR1 or one normal allele plus an unamplified premutation allele. Therefore, these women were also further investigated using the FragilEase PCR kit. It was shown that 57 out of 58 individuals (98.3%) were homozygotes with normal alleles ranging from 24 to 39 repeats, consistent with our initial screening. Interestingly, only one of the 58 women carried a FMR1 premutation of 112 CGG repeats [Figure 2]. This case was a 24-year-old nulliparous female with normal mental and hematological parameters. The serum FSH level of >80 IU/L, which was measured twice, >1 month apart, confirmed the diagnosis of POI. The prevalence of the FMR1 premutation in our POI patients was 0.7% (1/153).
Figure 2: (a) Electropherogram of the premutation as detected by the Agilent Bioanalyzer. (b) Corresponding results generated by FRAXSOFT analysis software. The woman was found to have a FMR1 premutation with a CGG repeat number of 112.

Click here to view



  Discussion Top


The polymorphic trinucleotide repeat in the FMR1 gene is associated with three different disorders.[15] The full mutation of the FMR1 gene is responsible for the fragile X syndrome, the most common form of inherited mental retardation.[16] The relationship between fragile X-associated tremor/ataxia syndrome and POI may be explained by the premutation in the FMR1 gene.[15] Currently, several organizations and clinicians have recommended screening for FMR1 repeats in newborns and patients with the aforementioned clinical manifestations.[17] The precise detection of the FMR1 premutation and full mutation can help in early intervention and genetic counseling.

Based on the conventional FMR1-specific PCR assay, we developed a sensitive and cost-effective method with an optimized PCR mix and cycling program to identify CGG repeats within the FMR1 gene. Our method has a high resolution of trinucleotide repeats, that is, one repeat difference can be distinguished on a 5% agarose gel by electrophoresis. Furthermore, all results have been confirmed by capillary electrophoresis. The rapid, low-cost, and highly sensitive assay is suitable for the screening of a large number of samples from patients with POI and other FMR1 repeat-associated disorders. The carriers of normal alleles can be efficiently excluded by our assay during the initial screening stage.

In our study, the contribution of the FMR1 premutation in sporadic POI was <1%, which is consistent with a previously published report on a northern Chinese population.[11] It was suggested that the frequent FMR1 premutation in Caucasian individuals with POI may not be a common genetic cause of sporadic POI in the Chinese Han population. Due to the low frequency of the FMR1 premutation in Han Chinese women with POI, it may be cost-effective to exclude the normal allele carriers first using our sensitive PCR-based method, which is convenient and appropriate for the initial screening of Han Chinese women with POI.

Acknowledgments

We would like to thank all the participants involved in this study and the PerkinElmer Medical Laboratory (Suzhou) for assistance with Fragile X molecular diagnostics. This work was supported by the National Key Research and Development Program of China (2016YFC0905100) and the National Natural Science Foundation of China (31625015, 31521003, and 31571297).

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Kato I, Toniolo P, Akhmedkhanov A, Koenig KL, Shore R, Zeleniuch-Jacquotte A. Prospective study of factors influencing the onset of natural menopause. J Clin Epidemiol 1998;51:1271-6. doi: 10.1016/S0895-4356(98)00119-X.  Back to cited text no. 1
    
2.
Fenton AJ. Premature ovarian insufficiency: Pathogenesis and management. J Midlife Health 2015;6:147-53. doi: 10.4103/0976-7800.172292.  Back to cited text no. 2
    
3.
Qin Y, Jiao X, Simpson JL, Chen ZJ. Genetics of primary ovarian insufficiency: New developments and opportunities. Hum Reprod Update 2015;21:787-808. doi: 10.1093/humupd/dmv036.  Back to cited text no. 3
    
4.
Goswami D, Conway GS. Premature ovarian failure. Hum Reprod Update 2005;11:391-410. doi: 10.1093/humupd/dmi012.  Back to cited text no. 4
    
5.
Persani L, Rossetti R, Cacciatore C. Genes involved in human premature ovarian failure. J Mol Endocrinol 2010;45:257-79. doi: 10.1677/JME-10-0070.  Back to cited text no. 5
    
6.
Barasoain M, Barrenetxea G, Huerta I, Télez M, Criado B, Arrieta I. Study of the genetic etiology of primary ovarian insufficiency: FMR1 Gene. Genes (Basel) 2016;7. pii: E123. doi: 10.3390/genes7120123.  Back to cited text no. 6
    
7.
Kronquist KE, Sherman SL, Spector EB. Clinical significance of tri-nucleotide repeats in fragile X testing: A clarification of American College of Medical Genetics Guidelines. Genet Med 2008;10:845-7. doi: 10.1097/GIM.0b013e31818b0c8a.  Back to cited text no. 7
    
8.
Cronister A, Schreiner R, Wittenberger M, Amiri K, Harris K, Hagerman RJ. Heterozygous fragile X female: Historical, physical, cognitive, and cytogenetic features. Am J Med Genet 1991;38:269-74. doi: 10.1002/ajmg.1320380221.  Back to cited text no. 8
    
9.
Allingham-Hawkins DJ, Babul-Hirji R, Chitayat D, Holden JJ, Yang KT, Lee C, et al. Fragile X premutation is a significant risk factor for premature ovarian failure: The International Collaborative POF in fragile X study – Preliminary data. Am J Med Genet 1999;83:322-5. doi: 10.1002/(SICI)1096-8628(19990402)83:4<322::AID-AJMG17>3.3.CO;2-2.  Back to cited text no. 9
    
10.
Eslami A, Farahmand K, Totonchi M, Madani T, Asadpour U, Zari Moradi S, et al. FMR1 premutation: Not only important in premature ovarian failure but also in diminished ovarian reserve. Hum Fertil (Camb) 2017;20:120-5. doi: 10.1080/14647273.2016.1255356.  Back to cited text no. 10
    
11.
Guo T, Qin Y, Jiao X, Li G, Simpson JL, Chen ZJ. FMR1 premutation is an uncommon explanation for premature ovarian failure in Han Chinese. PLoS One 2014;9:e103316. doi: 10.1371/journal.pone.0103316.  Back to cited text no. 11
    
12.
Fu YH, Kuhl DP, Pizzuti A, Pieretti M, Sutcliffe JS, Richards S, et al. Variation of the CGG repeat at the fragile X site results in genetic instability: Resolution of the Sherman paradox. Cell 1991;67:1047-58. doi: 10.1016/0092-8674(91)90283-5.  Back to cited text no. 12
    
13.
Hantash FM, Goos DG, Tsao D, Quan F, Buller-Burckle A, Peng M, et al. Qualitative assessment of FMR1 (CGG) n triplet repeat status in normal, intermediate, premutation, full mutation, and mosaic carriers in both sexes: Implications for fragile X syndrome carrier and newborn screening. Genet Med 2010;12:162-73. doi: 10.1097/GIM.0b013e3181d0d40e.  Back to cited text no. 13
    
14.
Kwok YK, Wong KM, Lo FM, Kong GW, Moore JK, Wu S, et al. Validation of a robust PCR-based assay for quantifying fragile X CGG repeats. Clin Chim Acta 2016;456:137-43. doi: 10.1016/j.cca. 2016.02.027.  Back to cited text no. 14
    
15.
Hagerman RJ, Hagerman PJ. Testing for fragile X gene mutations throughout the life span. JAMA 2008;300:2419-21. doi: 10.1001/jama. 2008.684.  Back to cited text no. 15
    
16.
Penagarikano O, Mulle JG, Warren ST. The pathophysiology of fragile X syndrome. Annu Rev Genomics Hum Genet 2007;8:109-29. doi: 10.1146/annurev.genom.8.080706.092249.  Back to cited text no. 16
    
17.
Wittenberger MD, Hagerman RJ, Sherman SL, McConkie-Rosell A, Welt CK, Rebar RW, et al. The FMR1 premutation and reproduction. Fertil Steril 2007;87:456-65. doi: 10.1016/j.fertnstert.2006.09.004.  Back to cited text no. 17
    


    Figures

  [Figure 1], [Figure 2]


This article has been cited by
1 Whole-exome sequencing reveals SALL4 variants in premature ovarian insufficiency: an update on genotype–phenotype correlations
Qiqi Wang,Da Li,Baozhu Cai,Qing Chen,Caihua Li,Yanhua Wu,Li Jin,Xiuxia Wang,Xiaojin Zhang,Feng Zhang
Human Genetics. 2019;
[Pubmed] | [DOI]
2 Premutations of FMR1 CGG repeats are not related to idiopathic premature ovarian failure in Iranian patients: A case control study
Rezvaneh Asadi,Mir Davood Omrani,Hamid Ghaedi,Reza Mirfakhraie,Eznollah Azargashb,Mohsen Habibi,Farkhondeh Pouresmaeili
Gene. 2018; 676: 189
[Pubmed] | [DOI]



 

Top
 
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Methods
Results
Discussion
References
Article Figures

 Article Access Statistics
    Viewed1713    
    Printed158    
    Emailed0    
    PDF Downloaded272    
    Comments [Add]    
    Cited by others 2    

Recommend this journal


[TAG2]
[TAG3]
[TAG4]